Analysis of splicing patterns by pyrosequencing
نویسندگان
چکیده
Several different mRNAs can be produced from a given pre-mRNA by regulated alternative splicing, or as the result of deregulations that may lead to pathological states. Analysing splicing patterns is therefore of importance to describe and understand developmental programs, cellular responses to internal or external cues, or human diseases. We describe here a method, Pyrosequencing Analysis of Splicing Patterns (PASP), that combines RT-PCR and pyrosequencing of PCR products. We demonstrated that: (i) Ratios of two pure RNAs mixed in various proportions were accurately measured by PASP; (ii) PASP can be adapted to virtually any splicing event, including mutually exclusive exons, complex patterns of exon skipping or inclusion, and alternative 3' terminal exons; (iii) In extracts from different organs, the proportions of RNA isoforms measured by PASP reflected those measured by other methods. The PASP method is therefore reliable for analysing splicing patterns. All steps are done in 96-wells microplates, without gel electrophoresis, opening the way to high-throughput comparisons of RNA from several sources.
منابع مشابه
Sodium Butyrate and Valproic Acid as Splicing Restoring Agents in Erythroid Cells of b-Thalassemic Patients
Background: b-Thalassemia is a common autosomal recessive disorder in human caused by a defect in b-globin chain synthesis. The most common mutations causing b-Thalassemia have been found to be splicing mutations. Most of which activate aberrant cryptic splicing/sites without complete disruption of normal splicing. IVSI-110 mutation, a common splicing mutation, leads to a 90% reduction of norma...
متن کاملAssessing differential expression measurements by highly parallel pyrosequencing and DNA microarrays: a comparative study.
To explore the feasibility of pyrosequencing for quantitative differential gene expression analysis we have performed a comparative study of the results of the sequencing experiments to those obtained by a conventional DNA microarray platform. A conclusion from our analysis is that, over a threshold of 35 normalized reads per gene, the measurements of gene expression display a good correlation ...
متن کاملAntisense Oligonucleotide Mediated Splice Correction of a Deep Intronic Mutation in OPA1
Inherited optic neuropathies (ION) present an important cause of blindness in the European working-age population. Recently we reported the discovery of four independent families with deep intronic mutations in the main inherited optic neuropathies gene OPA1. These deep intronic mutations cause mis-splicing of the OPA1 pre-messenger-RNA transcripts by creating cryptic acceptor splice sites. As ...
متن کاملAn improved procedure for clustering and assembly of large transcriptome data
Motivations Expressed sequence tags and full-length cDNAs represent an invaluable source of evidence for inferring reliable gene structures and discovering potential alternative splicing events [1]. However, to fully exploit their biological potential, correct and reliable EST clusters are required. To fill this gap we developed the program EasyCluster that resulted the most accurate when compa...
متن کاملTranscriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.
Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
دوره 37 شماره
صفحات -
تاریخ انتشار 2009